ID: 1116683794_1116683801

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1116683794 1116683801
Species Human (GRCh38) Human (GRCh38)
Location 14:48011733-48011755 14:48011747-48011769
Sequence CCGGACTCGGGGTACCCGCCGGG CCCGCCGGGTGGTGTGGGGCTGG
Strand - +
Off-target summary No data {0: 6, 1: 21, 2: 29, 3: 53, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!