ID: 1116766229_1116766230

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1116766229 1116766230
Species Human (GRCh38) Human (GRCh38)
Location 14:49073493-49073515 14:49073527-49073549
Sequence CCAGACAGAAAATCAACAAAGAA AATCTGCTCTATAGAACAAATGG
Strand - +
Off-target summary {0: 322, 1: 596, 2: 602, 3: 679, 4: 1807} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!