|
Left Crispr |
Right Crispr |
| Crispr ID |
1117058062 |
1117058066 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:51933075-51933097
|
14:51933100-51933122
|
| Sequence |
CCTAGAGCCTCTGGCAGGAGCAT |
CTCTGCTGGCACCTTGATTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 23, 3: 130, 4: 828} |
{0: 2, 1: 82, 2: 594, 3: 1800, 4: 3788} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|