ID: 1117156820_1117156827

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1117156820 1117156827
Species Human (GRCh38) Human (GRCh38)
Location 14:52950635-52950657 14:52950649-52950671
Sequence CCCACCGAATTCGCAGCGCCGGC AGCGCCGGCCACGGGCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21} {0: 1, 1: 0, 2: 2, 3: 17, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!