ID: 1117156821_1117156840

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1117156821 1117156840
Species Human (GRCh38) Human (GRCh38)
Location 14:52950636-52950658 14:52950685-52950707
Sequence CCACCGAATTCGCAGCGCCGGCC GGGGCTTTCGGCAGAAACTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26} {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!