ID: 1117156822_1117156828

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1117156822 1117156828
Species Human (GRCh38) Human (GRCh38)
Location 14:52950639-52950661 14:52950652-52950674
Sequence CCGAATTCGCAGCGCCGGCCACG GCCGGCCACGGGCTGGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 24} {0: 1, 1: 1, 2: 2, 3: 53, 4: 591}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!