ID: 1117156831_1117156842

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1117156831 1117156842
Species Human (GRCh38) Human (GRCh38)
Location 14:52950657-52950679 14:52950689-52950711
Sequence CCACGGGCTGGGAGGTGGTGGAG CTTTCGGCAGAAACTCGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 552} {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!