ID: 1117242154_1117242155

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1117242154 1117242155
Species Human (GRCh38) Human (GRCh38)
Location 14:53844915-53844937 14:53844939-53844961
Sequence CCTAACTATAGCTAGATGGCATG AATGCCTCATTTTGATCTCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!