ID: 1117375347_1117375359

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1117375347 1117375359
Species Human (GRCh38) Human (GRCh38)
Location 14:55113904-55113926 14:55113946-55113968
Sequence CCCACCTTGGCCTCCCAAAGTGC CCACCATGCCTGGCTAAAGCTGG
Strand - +
Off-target summary {0: 28733, 1: 128252, 2: 230554, 3: 215949, 4: 130370} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!