ID: 1117375348_1117375359

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1117375348 1117375359
Species Human (GRCh38) Human (GRCh38)
Location 14:55113905-55113927 14:55113946-55113968
Sequence CCACCTTGGCCTCCCAAAGTGCT CCACCATGCCTGGCTAAAGCTGG
Strand - +
Off-target summary {0: 55360, 1: 145174, 2: 158991, 3: 100124, 4: 51656} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!