ID: 1117898326_1117898335

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1117898326 1117898335
Species Human (GRCh38) Human (GRCh38)
Location 14:60509686-60509708 14:60509724-60509746
Sequence CCAGGAGGCTGAGAAGCTGCGTG CTGTGGACAAGTACCGAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 424} {0: 1, 1: 0, 2: 0, 3: 6, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!