ID: 1118024069_1118024079

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1118024069 1118024079
Species Human (GRCh38) Human (GRCh38)
Location 14:61751165-61751187 14:61751204-61751226
Sequence CCTCAGTACGTGCTCGGGCGCAG CCCGCCCGCGGCCCCGGCCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 15, 3: 177, 4: 805}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!