ID: 1118375766_1118375776

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1118375766 1118375776
Species Human (GRCh38) Human (GRCh38)
Location 14:65175746-65175768 14:65175782-65175804
Sequence CCTCAAGTGATCCTCCCATCTTG CTGGGATTACAGATGAGCCACGG
Strand - +
Off-target summary {0: 133, 1: 1489, 2: 8767, 3: 31781, 4: 68126} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!