ID: 1118375769_1118375776

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1118375769 1118375776
Species Human (GRCh38) Human (GRCh38)
Location 14:65175760-65175782 14:65175782-65175804
Sequence CCCATCTTGGCCTCCCAAAGTGC CTGGGATTACAGATGAGCCACGG
Strand - +
Off-target summary {0: 2150, 1: 37816, 2: 142479, 3: 236649, 4: 210029} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!