ID: 1118483205_1118483207

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1118483205 1118483207
Species Human (GRCh38) Human (GRCh38)
Location 14:66188277-66188299 14:66188297-66188319
Sequence CCTTGCTAGATTGGGGAAGTTCT TCTCCTGGATAATGTCCTGCAGG
Strand - +
Off-target summary {0: 3913, 1: 2579, 2: 1239, 3: 502, 4: 247} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!