|
Left Crispr |
Right Crispr |
Crispr ID |
1118526620 |
1118526622 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:66651729-66651751
|
14:66651762-66651784
|
Sequence |
CCTGTCTTTGTGAAGCAGGGTTT |
CAGCAACCAAAATGAGATTATGG |
Strand |
- |
+ |
Off-target summary |
{0: 7, 1: 30, 2: 30, 3: 30, 4: 194} |
{0: 9, 1: 11, 2: 20, 3: 22, 4: 193} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|