ID: 1118547346_1118547348

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1118547346 1118547348
Species Human (GRCh38) Human (GRCh38)
Location 14:66906183-66906205 14:66906211-66906233
Sequence CCTACAGCGTGGTACTGCTGAAC TCATGATTTAGCATCTCCTTTGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 19, 3: 63, 4: 114} {0: 1, 1: 0, 2: 3, 3: 24, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!