ID: 1118692695_1118692700

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1118692695 1118692700
Species Human (GRCh38) Human (GRCh38)
Location 14:68354969-68354991 14:68355015-68355037
Sequence CCAGTATTAGGGTACTATCCGAG ACTCTAGTGAGTAAGCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21} {0: 1, 1: 0, 2: 1, 3: 5, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!