ID: 1118889602_1118889604

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1118889602 1118889604
Species Human (GRCh38) Human (GRCh38)
Location 14:69897103-69897125 14:69897116-69897138
Sequence CCATGGAACTGGAGGGGCAGTGC GGGGCAGTGCCTGGCTTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 199} {0: 1, 1: 0, 2: 1, 3: 28, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!