ID: 1120024779_1120024782

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1120024779 1120024782
Species Human (GRCh38) Human (GRCh38)
Location 14:79570547-79570569 14:79570567-79570589
Sequence CCCTGAGATGCTGACTGTGCAAG AAGGCTGTTCAGACCCAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 174} {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!