ID: 1120058660_1120058669

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1120058660 1120058669
Species Human (GRCh38) Human (GRCh38)
Location 14:79955484-79955506 14:79955530-79955552
Sequence CCTTTTCAGACAAGCAAATGTTG TGCCTTGCAAAACTCCTGAAGGG
Strand - +
Off-target summary {0: 17, 1: 411, 2: 3935, 3: 2481, 4: 1248} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!