ID: 1120061649_1120061653

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1120061649 1120061653
Species Human (GRCh38) Human (GRCh38)
Location 14:79990399-79990421 14:79990421-79990443
Sequence CCTTTTGTGTGGGAGAAGGAAGA ATGATGTTATAGGTTGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 372} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!