ID: 1120067168_1120067173

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1120067168 1120067173
Species Human (GRCh38) Human (GRCh38)
Location 14:80056239-80056261 14:80056274-80056296
Sequence CCCCCAGGCCTGGGGTGTGTGTG CTCCTTTGCAACTCAGCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 95, 4: 559} {0: 1, 1: 0, 2: 0, 3: 14, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!