ID: 1120129533_1120129538

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1120129533 1120129538
Species Human (GRCh38) Human (GRCh38)
Location 14:80788723-80788745 14:80788741-80788763
Sequence CCTTACCCTACTTCTCCTCTCGG CTCGGTCAACCCTACAATTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 205} {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!