ID: 1120579052_1120579057

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1120579052 1120579057
Species Human (GRCh38) Human (GRCh38)
Location 14:86223570-86223592 14:86223587-86223609
Sequence CCCAGGGCCTTCTGCTGGAGAAC GAGAACATGGACCAGTAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!