ID: 1120771255_1120771269

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1120771255 1120771269
Species Human (GRCh38) Human (GRCh38)
Location 14:88382954-88382976 14:88383001-88383023
Sequence CCCCTTTGCCCTTCCACCATGAT CATGCTTTCTGTACAGCCTATGG
Strand - +
Off-target summary {0: 15, 1: 34, 2: 223, 3: 1338, 4: 2568} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!