ID: 1120771263_1120771269

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1120771263 1120771269
Species Human (GRCh38) Human (GRCh38)
Location 14:88382984-88383006 14:88383001-88383023
Sequence CCTGAGGCCTCCCCAGCCATGCT CATGCTTTCTGTACAGCCTATGG
Strand - +
Off-target summary {0: 1147, 1: 2922, 2: 4399, 3: 4524, 4: 3298} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!