ID: 1121137803_1121137806

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1121137803 1121137806
Species Human (GRCh38) Human (GRCh38)
Location 14:91513973-91513995 14:91514013-91514035
Sequence CCAGGCTGGAGTGCAGTAGCACA CCTCTGTCTCCCCAGGTTCAAGG
Strand - +
Off-target summary {0: 871, 1: 29296, 2: 92969, 3: 183618, 4: 211659} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!