|
Left Crispr |
Right Crispr |
| Crispr ID |
1121167663 |
1121167664 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:91822756-91822778
|
14:91822787-91822809
|
| Sequence |
CCAGGCTGGAGTGCAGTGGCGTG |
TCACTGTAAGCTCTGTCTTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 22044, 1: 109955, 2: 188319, 3: 217928, 4: 158300} |
{0: 1, 1: 33, 2: 1481, 3: 23621, 4: 110388} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|