ID: 1121238301_1121238311

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1121238301 1121238311
Species Human (GRCh38) Human (GRCh38)
Location 14:92409579-92409601 14:92409628-92409650
Sequence CCAGGTCAAGAAACAAAATATTA CCTAACATGCTCCCCAGGATAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 31, 3: 188, 4: 860} {0: 1, 1: 0, 2: 1, 3: 8, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!