ID: 1121402543_1121402549

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1121402543 1121402549
Species Human (GRCh38) Human (GRCh38)
Location 14:93692883-93692905 14:93692923-93692945
Sequence CCAGCGTCTTGTTATGGGGACAC TTTGTGAGGAGCAGGGGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68} {0: 1, 1: 0, 2: 1, 3: 30, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!