ID: 1121402544_1121402550

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1121402544 1121402550
Species Human (GRCh38) Human (GRCh38)
Location 14:93692905-93692927 14:93692926-93692948
Sequence CCATCAATAGAGTTCTTGTTTGT GTGAGGAGCAGGGGACCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 190} {0: 1, 1: 0, 2: 7, 3: 81, 4: 634}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!