ID: 1121457239_1121457249

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1121457239 1121457249
Species Human (GRCh38) Human (GRCh38)
Location 14:94046249-94046271 14:94046288-94046310
Sequence CCATTGTAGAAAAATGGGGCCTC GGGGCAGTGCCTCTCTGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 106} {0: 1, 1: 0, 2: 0, 3: 22, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!