ID: 1121490289_1121490296

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1121490289 1121490296
Species Human (GRCh38) Human (GRCh38)
Location 14:94353884-94353906 14:94353930-94353952
Sequence CCAATCTCCAAAATATGCTCACA CTTCAACATAAGAATTTTTGGGG
Strand - +
Off-target summary No data {0: 5, 1: 54, 2: 471, 3: 1769, 4: 3645}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!