ID: 1121573254_1121573259

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1121573254 1121573259
Species Human (GRCh38) Human (GRCh38)
Location 14:94963247-94963269 14:94963291-94963313
Sequence CCATGGTCTTAGAGGAAGATGGG CATCCTATGCTGAAAGTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 184} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!