ID: 1121741094_1121741111

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1121741094 1121741111
Species Human (GRCh38) Human (GRCh38)
Location 14:96252876-96252898 14:96252925-96252947
Sequence CCTTCCCACCCCAGAGCCAGCAC TGCCAGGCCATGGCAGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 602} {0: 1, 1: 0, 2: 1, 3: 55, 4: 502}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!