ID: 1122004558_1122004560

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1122004558 1122004560
Species Human (GRCh38) Human (GRCh38)
Location 14:98691325-98691347 14:98691359-98691381
Sequence CCTACCTCATAGAGAGACAGGCA CAATAATGAGTGCAGATATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!