ID: 1122057845_1122057847

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1122057845 1122057847
Species Human (GRCh38) Human (GRCh38)
Location 14:99117015-99117037 14:99117030-99117052
Sequence CCGTAAGATGGTATTAGACCCAT AGACCCATTTTTACAACTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!