ID: 1122076022_1122076030

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1122076022 1122076030
Species Human (GRCh38) Human (GRCh38)
Location 14:99235114-99235136 14:99235147-99235169
Sequence CCCCATCCGGGTTTCAGGGGGAA CCCCACCCCTGAAGCCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81} {0: 1, 1: 1, 2: 2, 3: 42, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!