ID: 1122080069_1122080079

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1122080069 1122080079
Species Human (GRCh38) Human (GRCh38)
Location 14:99260993-99261015 14:99261041-99261063
Sequence CCCTCCCACTTTCAGCGTTGAAA TTCACCCGATTCCAAAGAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 125} {0: 1, 1: 0, 2: 1, 3: 9, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!