ID: 1122480227_1122480235

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1122480227 1122480235
Species Human (GRCh38) Human (GRCh38)
Location 14:102042453-102042475 14:102042489-102042511
Sequence CCTGCAGCCGCATGCCTGCTTCC CATGGAGATCAACCCCAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 286} {0: 1, 1: 0, 2: 0, 3: 6, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!