ID: 1122500387_1122500393

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1122500387 1122500393
Species Human (GRCh38) Human (GRCh38)
Location 14:102194236-102194258 14:102194268-102194290
Sequence CCTTTGATTATGGCCTCGATAAG CCGAAACCTAATCCAGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52} {0: 1, 1: 0, 2: 7, 3: 140, 4: 601}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!