ID: 1122639139_1122639147

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1122639139 1122639147
Species Human (GRCh38) Human (GRCh38)
Location 14:103147064-103147086 14:103147105-103147127
Sequence CCTGGGCAACATAGTGAGACCCC TTTGCCTCTTTCTTCATAGTAGG
Strand - +
Off-target summary {0: 3152, 1: 14672, 2: 56782, 3: 188710, 4: 346538} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!