ID: 1122775612_1122775628

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1122775612 1122775628
Species Human (GRCh38) Human (GRCh38)
Location 14:104115846-104115868 14:104115891-104115913
Sequence CCCCACCCCCATGCCGCAGCCCC GAGACCCACAGATGCAGCGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!