ID: 1122888805_1122888816

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1122888805 1122888816
Species Human (GRCh38) Human (GRCh38)
Location 14:104723421-104723443 14:104723452-104723474
Sequence CCCTCCACAGGCTGGGCCGGGAA GTGGGACCTCTTGGGAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 210} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!