ID: 1122954516_1122954523

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1122954516 1122954523
Species Human (GRCh38) Human (GRCh38)
Location 14:105064321-105064343 14:105064357-105064379
Sequence CCCATCCAAAGCCCATTGTCAAC CCAATTTGATAGTGTTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124} {0: 1, 1: 0, 2: 0, 3: 11, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!