ID: 1122975436_1122975442

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1122975436 1122975442
Species Human (GRCh38) Human (GRCh38)
Location 14:105168904-105168926 14:105168918-105168940
Sequence CCTGCCAGCGCCCCGGCCCGGCG GGCCCGGCGCGCGCCCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 57, 4: 546} {0: 1, 1: 0, 2: 1, 3: 23, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!