ID: 1122975807_1122975816

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1122975807 1122975816
Species Human (GRCh38) Human (GRCh38)
Location 14:105170292-105170314 14:105170309-105170331
Sequence CCACCTCTCCTGTGCTTTGGCCT TGGCCTGGGGGCAGGTACTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 373} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!