ID: 1123027351_1123027356

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1123027351 1123027356
Species Human (GRCh38) Human (GRCh38)
Location 14:105432954-105432976 14:105432993-105433015
Sequence CCGCCTGAGCTTCAGTCGAAAGC AACCCCGTGCTGTAATATAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 41} {0: 1, 1: 0, 2: 0, 3: 3, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!