ID: 1123027352_1123027356 |
View in Genome Browser |
Spacer: 13 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1123027352 | 1123027356 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 14:105432957-105432979 | 14:105432993-105433015 |
| Sequence | CCTGAGCTTCAGTCGAAAGCGAT | AACCCCGTGCTGTAATATAGGGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 27} | {0: 1, 1: 0, 2: 0, 3: 3, 4: 30} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||